Stem-loop sequence bdi-MIR395c

Accession

MI0018127

Description

Brachypodium distachyon miR395c stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

----ggcggcagaccac              u         g            - a     aau 
                 guuugguaauacca gaguucccu caagcacuucau g ggccu   u
                 |||||||||||||| ||||||||| |||||||||||| | |||||    
                 cgaaccauuguggu cucaagggg guuugugaagug c ucggg   c
gaggaaaacaacauuuu              u         -            u a     aau 

Genome context

• Coordinates (v1.0): chr5: 25455997-25456122 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bdi-MIR395c

• bdi-MIR395e: chr5: 25455195-25455344 [+]
• bdi-MIR395f: chr5: 25455426-25455521 [+]
• bdi-MIR395g: chr5: 25455723-25455811 [+]
• bdi-MIR395h: chr5: 25455882-25455957 [+]
• bdi-MIR395c: chr5: 25455997-25456122 [+]
• bdi-MIR395j: chr5: 25456151-25456238 [+]
• bdi-MIR395k: chr5: 25456290-25456375 [+]
• bdi-MIR395l: chr5: 25456562-25456657 [+]
• bdi-MIR395n: chr5: 25457116-25457205 [+]

Mature sequence bdi-miR395c

• Accession: MIMAT0020702
• Sequence: 75 - ugaaguguuugggggaacuc - 94
• Evidence: experimental; Solexa [1]

References

1. PMID:19772667 "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" Zhang J, Xu Y, Huan Q, Chong K BMC Genomics. 10:449(2009).
2. PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).