Stem-loop sequence bdi-MIR396b

AccessionMI0018125 (change log)
DescriptionBrachypodium distachyon miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention bdi-MIR396b
(4 sentences)

Stem-loop
   ----   -  -  uaaaa      c    g    c      ca                g   uc       uguucuccucugaauugugucgugga 
5'     gga gu ag     gagaug gcgg caug uuucca  ggcuuucuugaacugu aac  guggggg                          a
       ||| || ||     |||||| |||| |||| ||||||  |||||||||||||||| |||  |||||||                          u
3'     ccu cg uc     uucuac cgcc guac aaaggu  ccgaaagaacuuggua uug  cgccucu                          u
   ugcc   g  c  --ugg      -    -    c      ac                g   uc       cuagcugccuauuucuuguucgggcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 27112463-27112651 [+]
intergenic
Database links

Mature sequence bdi-miR396b-5p

Accession MIMAT0020700
Sequence

32 - 

uccacaggcuuucuugaacug

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR396b-3p

Accession MIMAT0027072
Sequence

138 - 

guucaagaaagcccauggaaa

 - 158

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).