Stem-loop sequence bdi-MIR156d

AccessionMI0018122
DescriptionBrachypodium distachyon miR156d stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --gccggccggcagggucaugugugcgcgc         -    -         a      ggcgg         cgg 
5'                               ggugacaga agag agugagcac cggccg     gacggcacc   c
                                 ||||||||| |||| ||||||||| ||||||     |||||||||   g
3'                               ccacugucu ucuc ucacucgug gccggc     cugccgugg   g
   acaggcacuucuccgccggaagacccguuu         g    g         c      ----g         uua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21) Overlapping transcripts
5: 18202182-18202332 [-]
intergenic

Mature sequence bdi-miR156d-5p

Accession MIMAT0020697
Sequence

31 - 

ugacagaagagagugagcac

 - 50

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR156d-3p

Accession MIMAT0027069
Sequence

100 - 

gcucacugcucugucugucacc

 - 121

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).