Stem-loop sequence bdi-MIR396a

AccessionMI0018111 (change log)
DescriptionBrachypodium distachyon miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention bdi-MIR396a
(5 sentences)

Stem-loop
   ---  g    -ucaauuac    u         cuc    ca                g   ucgugcgccuagccugcuagcugcucaauucgaucugucauccu 
5'    gc cggc         aggu gcggccaug   ucca  ggcuuucuugaacugu aac                                            c
      || ||||         |||| |||||||||   ||||  |||||||||||||||| |||                                             
3'    cg gucg         uccg cgccgguac   aggu  cugaaagaacuuggua uug                                            g
   auu  -    uccccuuuc    c         aaa    uc                g   uuccguguaguauaguauauguucguuaagucuagcuuagcuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 59349783-59349991 [-]
intergenic
Database links

Mature sequence bdi-miR396a-5p

Accession MIMAT0020686
Sequence

33 - 

uccacaggcuuucuugaacug

 - 53

Get sequence
Evidence experimental; Illumina [1,3]

Mature sequence bdi-miR396a-3p

Accession MIMAT0027062
Sequence

156 - 

guucaagaaaguccuuggaaa

 - 176

Get sequence
Evidence experimental; Illumina [3]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
3
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).