Stem-loop sequence bdi-MIR172a

Accession

MI0018110

Description

Brachypodium distachyon miR172a stem-loop

Gene family

MIPF0000035; MIR172

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

--a     ---cacgcac     -   c    a         c  c        a     -    ---    ag    aau 
   ggcgg          agucg gcg uugc ggugcagca ca caagauuc caucg gguu   cucc  ucgu   u
   |||||          ||||| ||| |||| ||||||||| || |||||||| ||||| ||||   ||||  ||||   a
   cugcu          ucagc cgc aacg cuacgucgu gu guucuaag guagu ccaa   gagg  agca   a
uaa     auacuacuca     u   c    g         a  a        a     a    cau    --    auu 

Genome context

• Coordinates (v1.0): chr3: 55737301-55737453 [-]
• Overlapping transcripts:

  intergenic

Mature sequence bdi-miR172a

• Accession: MIMAT0020685
• Sequence: 99 - agaaucuugaugaugcugcau - 119
• Evidence: not experimental

References

1. PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).