Stem-loop sequence bdi-MIR396e

AccessionMI0018108 (change log)
DescriptionBrachypodium distachyon miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention bdi-MIR396e
(4 sentences)

Stem-loop
   cuc    ---aag     --     -----        c                   a     -      ggacugcggccuguagcucucucgcccucuugau 
5'    gagc      uaguu  agucc     augccauu cuuuccacagcuuucuuga cuucc cuuccc                                  c
      ||||      |||||  |||||     |||||||| ||||||||||||||||||| ||||| ||||||                                  u
3'    cuug      guuag  ucagg     uacgguaa gaagggugucgaaagaacu ggagg gaaggg                                  c
   -ua    acuuaa     uu     accaa        a                   g     a      acgagagggucgacgauggucaccucuagcugcc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 54962836-54963036 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR396e
bdi-MIR396e3: 54962836-54963036 [+]
bdi-MIR396c3: 54968138-54968290 [-]
Database links

Mature sequence bdi-miR396e-5p

Accession MIMAT0020683
Sequence

32 - 

uuccacagcuuucuugaacuu

 - 52

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR396e-3p

Accession MIMAT0027060
Sequence

143 - 

ggucaagaaagcugugggaag

 - 163

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).