Stem-loop sequence bdi-MIR156b

AccessionMI0018104
DescriptionBrachypodium distachyon miR156b stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   guguugu   a    u   aa   ua  ---------         -     -        a       c  acu     u    --c    --gcg  g --a  c      gc 
5'        ggc ggug ggc  ggc  ug         ggugacaga agaga gugagcac cagcggc ag   gcauc auuc   uucg     gc g   ca ggccgg  a
          ||| |||| |||  |||  ||         ||||||||| ||||| |||||||| ||||||| ||   ||||| ||||   ||||     || |   || ||||||   
3'        ccg ccgc ccg  ucg  ac         ccacugucu ucucu cacucgug gucgucg uc   cguag uaag   aagc     cg u   gu ccggcc  u
   -----cu   a    -   -a   gc  acacgcucu         c     u        c       -  -gu     -    caa    acaua  g acg  a      gg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21) Overlapping transcripts
3: 39258110-39258314 [-]
intergenic

Mature sequence bdi-miR156b-5p

Accession MIMAT0020679
Sequence

31 - 

ugacagaagagagugagcac

 - 50

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR156b-3p

Accession MIMAT0027057
Sequence

154 - 

gcucacuucucucucugucacc

 - 175

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).