Stem-loop sequence bdi-MIR399b

AccessionMI0018103 (change log)
DescriptionBrachypodium distachyon miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention bdi-MIR399b
(8 sentences)

Stem-loop
   --c    -u   g  au      -ga    ua   u           c     c  a  u  --ag       -g  g  aauc 
5'    gugu  auu ag  gagggu   gaau  cag gcgguucuccu uggca gg gg cg    gguagcc  gc gc    c
      ||||  ||| ||  ||||||   ||||  ||| ||||||||||| ||||| || || ||    |||||||  || ||     
3'    caua  ugg uc  cuccca   cuua  guc cguuaagagga accgu cc cc gc    ccgucgg  cg cg    g
   aua    uu   g  --      aua    cc   c           a     u  -  u  cuga       ag  g  accg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 7135266-7135425 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR399b
bdi-MIR399d3: 7132920-7133061 [-]
bdi-MIR399b3: 7135266-7135425 [+]
Database links

Mature sequence bdi-miR399b

Accession MIMAT0020678
Sequence

110 - 

ugccaaaggagaauugcccug

 - 130

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).