Stem-loop sequence bdi-MIR396c

AccessionMI0018101 (change log)
DescriptionBrachypodium distachyon miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention bdi-MIR396c
(4 sentences)

Stem-loop
   -cg  a  aa    ca     -       u   c            c           ggaucugccuaauuagauc 
5'    gu gc  aucg  uggcc cucucug gau uuccacagcuuu uugaacugcuc                   a
      || ||  ||||  ||||| ||||||| ||| |||||||||||| |||||||||||                    
3'    ca cg  uagu  accgg gagagac uua agggugucgaaa aacuugacggg                   c
   aua  -  gc    ua     a       u   a            u           agagcacguuuggguucgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 54968138-54968290 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR396c
bdi-MIR396c3: 54968138-54968290 [-]
bdi-MIR396e3: 54962836-54963036 [+]
Database links

Mature sequence bdi-miR396c-5p

Accession MIMAT0020676
Sequence

33 - 

uuccacagcuuucuugaacug

 - 53

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bdi-miR396c-3p

Accession MIMAT0027055
Sequence

102 - 

guucaauaaagcugugggaaa

 - 122

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).
2
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).