Stem-loop sequence osa-MIR5162

AccessionMI0018078 (change log)
DescriptionOryza sativa miR5162 stem-loop
Literature search

1 open access papers mention osa-MIR5162
(1 sentences)

Stem-loop
   u  uu      c                   a a       uuuccgaaauuuggauaaaauuaucaaaauaucauauuauuaacauaag 
5'  ca  uuuguc aaaugaccaaaauaccccu g acaaaaa                                                 c
    ||  |||||| ||||||||||||||||||| | |||||||                                                  
3'  gu  aaacag uuuacugguuuuaugggga c uguuuuu                                                 u
   u  uu      u                   c c       aagacuuuacagucuaaaauucaaaaaccgguuuaaaaccuacgaaugu 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 16421196-16421377 [+]
intergenic
Database links

Mature sequence osa-miR5162

Accession MIMAT0021115
Sequence

13 - 

aaaugaccaaaauaccccuagaac

 - 36

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).