Stem-loop sequence osa-MIR5161

AccessionMI0018077 (change log)
DescriptionOryza sativa miR5161 stem-loop
Literature search

2 open access papers mention osa-MIR5161
(4 sentences)

Stem-loop
   ----uu   ga       a      u    a              c   auucaaaucuuguuccacaauauaagcauuucuaccacuauuuacaccacuacuugucccaucaaucacuuuccauccaauuuuuucccc 
5'       cua  auauacu ccucug ucca aauauaagcauuuc agg                                                                                          a
         |||  ||||||| |||||| |||| |||||||||||||| |||                                                                                           
3'       gau  uauauga ggagac aggu uuauauucguaaag ucc                                                                                          u
   ucacuu   ag       g      u    c              a   aacaaaucguuucuaauuccaacuccuuuuuucugaaccacggggaguuauuuacucccucucaauccccccaacccccaacccccaacc 
Get sequence
Deep sequencing
34 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 12083553-12083828 [+]
intergenic
Database links

Mature sequence osa-miR5161

Accession MIMAT0021114
Sequence

245 - 

ucuggaucagagggaguaua

 - 264

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).