Stem-loop sequence osa-MIR5160

AccessionMI0018076 (change log)
DescriptionOryza sativa miR5160 stem-loop
Gene family MIPF0001604; MIR5160
Literature search

1 open access papers mention osa-MIR5160
(4 sentences)

Stem-loop
   ----cu                          a       a   a   ugacgucgugggcgguaucgugcagggaaagccggucucgcugauugaaauagcgauaccggacugccaccgauucaauuagugauuaauuaucaugauuagcgauuaauuaauuaauuauuaaucacuaaucaggauaauua 
5'       uuuugcagaaauauaccgucgaucuc cauaacc uug gca                                                                                                                                               g
         |||||||||||||||||||||||||| ||||||| ||| |||                                                                                                                                                
3'       aaaacgucuuuauaugguagcuagag guguugg aac cgu                                                                                                                                               u
   uuuaac                          c       c   g   uuucccgcucuggcgcgucagagcgccuugccuucucgccagagcgacuaacuuugucgcugugacagagugacuacguuacuagaggugaaaaauuaaucacuaauuaauggauuaauugauaauugauuauuauaaaucac 
Get sequence
Deep sequencing
539 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 2039472-2039851 [-]
intergenic
Database links

Mature sequence osa-miR5160

Accession MIMAT0021113
Sequence

348 - 

cgagaucgaugguauauuucug

 - 369

Get sequence
Deep sequencing146 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).