Stem-loop sequence osa-MIR5159

AccessionMI0018075 (change log)
DescriptionOryza sativa miR5159 stem-loop
Literature search

1 open access papers mention osa-MIR5159
(1 sentences)

Stem-loop 
   --u             g                 ccaa 
5'    guaccuguugacu acucugguucaacaaaa    u
      ||||||||||||| |||||||||||||||||     
3'    caugggcaacugg ugagaucaaguuguuuu    u
   acc             g                 cauu
Get sequence
Deep sequencing
14 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 11920712-11920787 [+]
intergenic
Database links

Mature sequence osa-miR5159

Accession MIMAT0021112
Sequence

51 -  

aacuagagugggucaacggguacc

 - 74

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).