Stem-loop sequence osa-MIR5158

AccessionMI0018074 (change log)
DescriptionOryza sativa miR5158 stem-loop
Literature search

2 open access papers mention osa-MIR5158
(4 sentences)

Stem-loop
   -----  a     a               -au    gu    ---u  gg      a  gc    aa     ug           c  a  uc au     c  a u                  -   -a     ca 
5'      uc gagua uucguccucauccca   gcuc  cauc    ac  uuggaa aa  caug  cuuua  uggcauaacgg uc cc  u  gggua ac g guggaagcggacaaaguc ucu  gcuca  a
        || ||||| |||||||||||||||   ||||  ||||    ||  |||||| ||  ||||  |||||  ||||||||||| || ||  |  ||||| || | |||||||||||||||||| |||  |||||   
3'      ag cucau aaguaggaguagggu   cgag  guag    ug  gaccuu uu  guac  gaaau  gccguguugcc ag gg  a  uccgu ug c cgccuucgccuguuucag aga  ugagu  a
   acaac  c     -               cac    ug    uagu  uu      c  aa    gg     gu           a  a  uu cg     c  g u                  u   gg     ag 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 23993370-23993635 [+]
intergenic
Database links

Mature sequence osa-miR5158

Accession MIMAT0021111
Sequence

231 - 

ugagccacugggaugaggaugaau

 - 254

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).