Stem-loop sequence osa-MIR5157a

AccessionMI0018072 (change log)
DescriptionOryza sativa miR5157a stem-loop
Gene family MIPF0001316; MIR5157
Stem-loop
   ----      a         a                        uc 
5'     gccuua gaacuuuuu auagcuacaacuucucucuuagaa  a
       |||||| ||||||||| ||||||||||||||||||||||||  a
3'     cggagu cuugaaaaa uaucgguguugaagagagaaucuu  c
   aucc      c         c                        cu 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 21476163-21476255 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5157a
osa-MIR156fChr8: 21478230-21478415 [+]
osa-MIR5157aChr8: 21476163-21476255 [-]
Database links

Mature sequence osa-miR5157a-5p

Accession MIMAT0021107
Sequence

9 - 

aacuuuuuaauagcuacaacuucu

 - 32

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence osa-miR5157a-3p

Accession MIMAT0021108
Sequence

58 - 

agaaguuguggcuaucaaaaaguu

 - 81

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).