Stem-loop sequence osa-MIR5156

AccessionMI0018071 (change log)
DescriptionOryza sativa miR5156 stem-loop
Literature search

1 open access papers mention osa-MIR5156
(1 sentences)

Stem-loop
   uc                                 a    a               - uag    ac ggga      ug -  aagaaaaauuugccgcgucgacacgcauccccgugucgauguguaucagacgcgggacgacgcgcaucggacacugcuagcgcgaguc 
5'   gugaggcaaaagccuguaaaacugcaaaaagga cauu ucucuccucucuccc c   uguu  c    cucccg  u cu                                                                                        c
     ||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |   ||||  |    ||||||  | ||                                                                                        a
3'   cacuccguuuucggacguuuugacguuuuuccu guaa agagaggagagaggg g   acga  g    gagggu  a ga                                                                                        a
   ca                                 -    g               a ugg    ga -aga      gu c  aauagggaugugugauguccugacgacgaucucgaaauaaugaaguggaacgucgugucgucgucgcuaacguugagaggaaaaccug 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 16955761-16956103 [-]
intergenic
Database links

Mature sequence osa-miR5156

Accession MIMAT0021106
Sequence

13 - 

agccuguaaaacugcaaaaaggaa

 - 36

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).