Stem-loop sequence osa-MIR5155

AccessionMI0018070 (change log)
DescriptionOryza sativa miR5155 stem-loop
Literature search

1 open access papers mention osa-MIR5155
(1 sentences)

Stem-loop
       c                            u    cauuuaaguuucuuuuuuuuuguuacugugguuuuuugcaugaaaaaaaagaaa 
5' aguu cugguacacuuuaauaccauuggaagau gcac                                                      g
   |||| |||||||||||||||||||||||||||| ||||                                                      a
3' ucga gacuaugugaaauuaugguggcuuucua ugug                                                      a
       a                            u    uuguaucaaccaaugguaggguaggugaauagauaaugacaaaucguaauggac 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 9179446-9179632 [-]
intergenic
Database links

Mature sequence osa-miR5155

Accession MIMAT0021105
Sequence

13 - 

acuuuaauaccauuggaagauugc

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).