Stem-loop sequence osa-MIR5154

AccessionMI0018069 (change log)
DescriptionOryza sativa miR5154 stem-loop
Stem-loop
   ----              ac  -aa    ac  c      uauacguuggcaugccgacuca 
5'     uuagacaucucagc  ca   uagc  gg gcugga                      g
       ||||||||||||||  ||   ||||  || ||||||                      c
3'     aaucuguggagucg  gu   guug  cc cgacuu                      c
   guug              ca  gca    -a  a      acggcacggugaugucuacccu 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 5263432-5263552 [+]
intergenic
Database links

Mature sequence osa-miR5154

Accession MIMAT0021104
Sequence

86 - 

agcaccaguugacgugacgcugag

 - 109

Get sequence
Deep sequencing37 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).