Stem-loop sequence osa-MIR5153

AccessionMI0018068 (change log)
DescriptionOryza sativa miR5153 stem-loop
Literature search

1 open access papers mention osa-MIR5153
(1 sentences)

Stem-loop
   ----     a ag   a           u   cu      c   uc     ga      --uau         aa               cuaccuuauaauuuuua 
5'     ccacg u  ugu uacguguuagu gga  cacgug uag  acaua  auaaaa     aauuagaaa  cauauuuucuccucu                 u
       ||||| |  ||| ||||||||||| |||  |||||| |||  |||||  ||||||     |||||||||  |||||||||||||||                  
3'     ggugc a  gca augcacaguca cuu  guguac guu  uguau  uauuuu     uuaauuuuu  guauaaaagaggaga                 c
   uuac     c cu   g           c   ag      a   --     -a      uaauu         -g               auccaucugucuuuuuu 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 2518353-2518558 [+]
intergenic
Database links

Mature sequence osa-miR5153

Accession MIMAT0021103
Sequence

171 - 

uggauuccacugacacguagacgu

 - 194

Get sequence
Deep sequencing58 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).