Stem-loop sequence osa-MIR5152

AccessionMI0018067 (change log)
DescriptionOryza sativa miR5152 stem-loop
Stem-loop
   ---------uaaa      g         a   cuu    -  c       u         c    c  c     ga   uuaaa      ----             aaacuucc 
5'              gguagg auaggcaug ucu   ucuc ac aaauuuc aagaccaaa ucaa uu guuug  aag     auaaga    caaauuuugcaug        c
                |||||| ||||||||| |||   |||| || ||||||| ||||||||| |||| || |||||  |||     ||||||    |||||||||||||        u
3'              ccaucc uauccguac aga   agag ug uuuaaag uucugguuu aguu aa cgaac  uuc     uguucu    guuugaaacgugc        a
   guauuuauaauca      a         c   uau    g  u       -         a    u  a     -g   ---ua      uuau             cuaucacu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 28910038-28910253 [-]
intergenic
Database links

Mature sequence osa-miR5152-5p

Accession MIMAT0021101
Sequence

6 - 

guagggauaggcaugaucucu

 - 26

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence osa-miR5152-3p

Accession MIMAT0021102
Sequence

184 - 

agaccaugccuauaccuacca

 - 204

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).