Stem-loop sequence osa-MIR5151

AccessionMI0018066 (change log)
DescriptionOryza sativa miR5151 stem-loop
Literature search

1 open access papers mention osa-MIR5151
(2 sentences)

Stem-loop
                                                       a      c    gaug   ga  g 
5' guuugcuucacuaaugauguggguacgaaugaacaaaaaugugacuauuuua gcuuca uguu    acu  ug c
   |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||    |||  ||  
3' caaacgaagugauuacuacauccaugcuuacuuguuuuuacacugauaaaau cgaagu acaa    uga  ac g
                                                       c      -    ----   gc  a 
Get sequence
Deep sequencing
97 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 3661490-3661638 [-]
intergenic
Database links

Mature sequence osa-miR5151

Accession MIMAT0021100
Sequence

12 - 

uaaugauguggguacgaaugaa

 - 33

Get sequence
Deep sequencing84 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2