Stem-loop sequence osa-MIR5150

AccessionMI0018065 (change log)
DescriptionOryza sativa miR5150 stem-loop
Literature search

5 open access papers mention osa-MIR5150
(7 sentences)

Stem-loop
   ----                                      
5'     guuugggggagcuucugacagcugcaguuucucuugu 
       |||||||||||||||||||||||||||||||||||| u
3'     caaacccccucgaagacugucgacgucgaagaggauc 
   ggua                                      
Get sequence
Deep sequencing
1139 reads, 550 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 18470790-18470868 [+]
intergenic
Database links

Mature sequence osa-miR5150-5p

Accession MIMAT0021098
Sequence

10 - 

agcuucugacagcugcaguuucuc

 - 33

Get sequence
Deep sequencing1033 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

Mature sequence osa-miR5150-3p

Accession MIMAT0021099
Sequence

44 - 

agaagcugcagcugucagaagcuc

 - 67

Get sequence
Deep sequencing102 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).