Stem-loop sequence osa-MIR5149

AccessionMI0018064 (change log)
DescriptionOryza sativa miR5149 stem-loop
Literature search

1 open access papers mention osa-MIR5149
(1 sentences)

Stem-loop
   ----   a              ca   a        aa   c                    -  c      a              uuaaaaauuuuccuuuuccuuuuuuuucuuuucuucuucucuuuuuuuuucuuuuauucucuucucuuuucucugugaccugagcaacccguguagcggugg 
5'     cau uaggucccaaaucg  aca cuccucca  auc uacguggcgcugauguggcg ug cacacg acgugacguggcau                                                                                                      c
       ||| ||||||||||||||  ||| ||||||||  ||| |||||||||||||||||||| || |||||| ||||||||||||||                                                                                                      c
3'     gua auccaggguuuagc  ugu gaggaggu  uag auguaccgugacuacaccgu ac gugugu uguacuguaccgua                                                                                                      u
   caca   c              ag   c        cc   a                    u  u      c              uuauaacuuacuguuuacucugggugaauuuuuuaaaaguaaagggaaaaaauaagagaaaaaaaaggaaagaagaggaaaagaacgagagugacgucgaua 
Get sequence
Deep sequencing
132 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 29756516-29756891 [-]
intergenic
Database links

Mature sequence osa-miR5149

Accession MIMAT0021097
Sequence

343 - 

gaggagcugugacgauuuggga

 - 364

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).