Stem-loop sequence osa-MIR5148c

AccessionMI0018063 (change log)
DescriptionOryza sativa miR5148c stem-loop
Gene family MIPF0001298; MIR5148
Stem-loop
   --   --            g         caa u   a  a 
5'   cac  gauaugacguuu uaccccuca   g aca gu u
     |||  |||||||||||| |||||||||   | ||| || a
3'   gug  cuauacuguaaa auggggagu   c ugu cg a
   gu   ua            g         -aa -   a  u 
Get sequence
Deep sequencing
138 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 2813203-2813281 [-]
intergenic
Database links

Mature sequence osa-miR5148c

Accession MIMAT0021096
Sequence

51 - 

ugagggguagaaaugucauaucau

 - 74

Get sequence
Deep sequencing97 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).