Stem-loop sequence osa-MIR5148b

AccessionMI0018062 (change log)
DescriptionOryza sativa miR5148b stem-loop
Gene family MIPF0001298; MIR5148
Stem-loop
   ---uac            g         --caa     ag 
5'       gauaugacguuu uaccccuca     guaua  u
         |||||||||||| |||||||||     |||||  a
3'       cuauacuguaaa auggggagu     uaugu  u
   ugugua            g         aacug     aa 
Get sequence
Deep sequencing
109 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 27436650-27436727 [+]
intergenic
Database links

Mature sequence osa-miR5148b

Accession MIMAT0021095
Sequence

51 - 

ugagggguagaaaugucauaucau

 - 74

Get sequence
Deep sequencing97 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).