Stem-loop sequence osa-MIR5148a

AccessionMI0018061 (change log)
DescriptionOryza sativa miR5148a stem-loop
Gene family MIPF0001298; MIR5148
Stem-loop
   -cac            g        ----   a   caa 
5'     gauaugacguuu uaccccuc    aca gua   a
       |||||||||||| ||||||||    ||| |||   u
3'     cuauacuguaaa auggggag    ugu cgu   a
   ugua            g        uaac   a   aau 
Get sequence
Deep sequencing
117 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 9968953-9969028 [-]
intergenic
Database links

Mature sequence osa-miR5148a

Accession MIMAT0021094
Sequence

51 - 

ugagggguagaaaugucauaucau

 - 74

Get sequence
Deep sequencing94 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).