Stem-loop sequence osa-MIR5147

AccessionMI0018059 (change log)
DescriptionOryza sativa miR5147 stem-loop
Stem-loop
   cuag     g                   a a      uuu    a    --ga   -     aacacuaacuccucugauccauuuauucaucuauauggauucauacgcagugucguuucguuuuucccgcauaucgcgcauacgcaaccaacagccccgcccucgugcacuggugccgcaug 
5'     uacuc cuccauccacgagaguugu c uauaac   uuuc cagu    cca aggag                                                                                                                          c
       ||||| ||||||||||||||||||| | ||||||   |||| ||||    ||| |||||                                                                                                                           
3'     augag gagguagguguucucaaca g guauug   aaag guca    ggu uucuc                                                                                                                          a
   -gua     g                   c c      --u    a    aaua   g     aacuugcauaaaacaaacacggagcuucgucauuagcauaccgacgccuaccuaauuaaacuauugcgccgggcucgucgguuggucaacucguacguguacguuaaccguuccguugacgu 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 17049859-17050224 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5147
osa-MIR437Chr2: 17050336-17050548 [-]
osa-MIR5147Chr2: 17049859-17050224 [-]
Database links

Mature sequence osa-miR5147

Accession MIMAT0021092
Sequence

339 - 

acaacucuuguggauggaggg

 - 359

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).