Stem-loop sequence osa-MIR5146

AccessionMI0018058 (change log)
DescriptionOryza sativa miR5146 stem-loop
Stem-loop
   ---------               -   -aa       a   cuau 
5'          uauaggugcugguuc uua   aaaaccg uac    a
            ||||||||||||||| |||   ||||||| |||    g
3'          auauccacggccaag aau   uuuuggc aug    u
   aaaugcuuc               u   caa       c   uuua 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 22418294-22418377 [+]
intergenic
Database links

Mature sequence osa-miR5146

Accession MIMAT0021091
Sequence

51 - 

uuuaacuaaugaaccggcaccuau

 - 74

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).