|
miRBase |
|
Stem-loop sequence osa-MIR5146 |
|||||
| Accession | MI0018058 | ||||
| Description | Oryza sativa miR5146 stem-loop | ||||
| Stem-loop |
--------- - -aa a cuau
uauaggugcugguuc uua aaaaccg uac a
||||||||||||||| ||| ||||||| ||| g
auauccacggccaag aau uuuuggc aug u
aaaugcuuc u caa c uuua
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence osa-miR5146 |
|
| Accession | MIMAT0021091 |
| Sequence |
51 - uuuaacuaaugaaccggcaccuau - 74 |
| Deep sequencing | 69 reads, 2 experiments |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"
RNA Biol. 8:538-547(2011).
|