Stem-loop sequence osa-MIR5145

AccessionMI0018057 (change log)
DescriptionOryza sativa miR5145 stem-loop
Stem-loop
   --cca         a    uga        uuaaaauuaaaau  g 
5'      ccuguuugg uucu   gggcuaau             gu a
        ||||||||| ||||   ||||||||             ||  
3'      ggacaaacc aaga   ccugauua             cg g
   cgccg         -    -ua        --------caaau  a 
Get sequence
Deep sequencing
378 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 40622637-40622718 [-]
intergenic
Database links

Mature sequence osa-miR5145

Accession MIMAT0021090
Sequence

3 - 

accuguuuggauucuugagggcua

 - 26

Get sequence
Deep sequencing340 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).