![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR5145 |
|||||
Accession | MI0018057 (change log) | ||||
Description | Oryza sativa miR5145 stem-loop | ||||
Stem-loop |
--cca a uga uuaaaauuaaaau g 5' ccuguuugg uucu gggcuaau gu a ||||||||| |||| |||||||| || 3' ggacaaacc aaga ccugauua cg g cgccg - -ua --------caaau a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR5145 |
|
Accession | MIMAT0021090 |
Sequence |
3 - accuguuuggauucuugagggcua - 26 |
Deep sequencing | 340 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
References |
|
1 |
PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"
RNA Biol. 8:538-547(2011).
|