Stem-loop sequence osa-MIR5144

AccessionMI0018056 (change log)
DescriptionOryza sativa miR5144 stem-loop
Literature search

1 open access papers mention osa-MIR5144
(1 sentences)

Stem-loop
           a                  a                c    g gacgucuucuucuucccauugaaggucucggucuucuccuucagcuccugcggcaugggacgacgagguggagcucgaguccucgaggaacuugugccgcaugggacgcccaccaagaaagccccccucgucgccccgccaccgccaccgccgccgccg 
5' uccauauu uucuucuugugcugcuga gagacucaccgaccuc ggcg c                                                                                                                                                               a
   |||||||| |||||||||||||||||| |||||||||||||||| |||| |                                                                                                                                                               a
3' agguauaa aagaagaacacgacgacu cucugaguggcuggag ccgu g                                                                                                                                                               c
           g                  c                c    a uggccuuagccugagaaccagcaguaggaguaguaguagccugccuccguguaagaacaaccggacuucgcgacccaagccguggccgucgcggagcagcagugaccuuagccugaaaaccggcaguagccuuagucuuagucuaagucugagaaccaa 
Get sequence
Deep sequencing
528 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 25326388-25326810 [-]
intergenic
Database links

Mature sequence osa-miR5144-5p

Accession MIMAT0021088
Sequence

13 - 

uucuugugcugcugaagagac

 - 33

Get sequence
Deep sequencing485 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR5144-3p

Accession MIMAT0021089
Sequence

392 - 

ucuccucagcagcacaagaag

 - 412

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).