Stem-loop sequence mmu-mir-5135

AccessionMI0018047
Symbol MGI:Mir5135
DescriptionMus musculus miR-5135 stem-loop
Stem-loop
gag      c   -    -a             -------  c 
   aggacu gga gccc  gccaccuagacuu       uc c
   |||||| ||| ||||  |||||||||||||       ||  
   uccugg ccu cggg  cgguggaucugga       ag a
uca      u   g    aa             cgcgaag  g 
Get sequence
Deep sequencing
30 reads, 0.497 reads per million, 17 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 76533134-76533212 [-]
intergenic
Database links

Mature sequence mmu-miR-5135

Accession MIMAT0020646
Sequence

47 - 

aggucuagguggcaagggcguccu

 - 70

Get sequence
Deep sequencing25 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).