Stem-loop sequence mmu-mir-466q

AccessionMI0018032 (change log)
Symbol MGI:Mir466q
DescriptionMus musculus miR-466q stem-loop
Gene family MIPF0000316; mir-467
Literature search

22 open access papers mention mmu-mir-466q
(56 sentences)

Stem-loop
   -       u                           u 
5'  gugugug guguguguguguguguguguaugugug g
    ||||||| ||||||||||||||||||||||||||| u
3'  uacguac caugcauacacacacacacguguauau a
   g       c                           g 
Get sequence
Deep sequencing
2372 reads, 3.16e+03 reads per million, 149 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 28419943-28420018 [+]
sense
OTTMUST00000075380 ; Tnik-004; intron 1
OTTMUST00000075379 ; Tnik-003; intron 2
OTTMUST00000075377 ; Tnik-001; intron 2
OTTMUST00000075378 ; Tnik-002; intron 2
OTTMUST00000075473 ; Tnik-016; intron 2
OTTMUST00000075383 ; Tnik-007; intron 2
OTTMUST00000075467 ; Tnik-010; intron 2
OTTMUST00000075465 ; Tnik-008; intron 2
OTTMUST00000075466 ; Tnik-009; intron 2
OTTMUST00000075468 ; Tnik-011; intron 2
OTTMUST00000075470 ; Tnik-013; intron 2
OTTMUST00000075471 ; Tnik-014; intron 2
ENSMUST00000161423 ; Tnik-004; intron 1
ENSMUST00000160934 ; Tnik-003; intron 2
ENSMUST00000159236 ; Tnik-001; intron 2
ENSMUST00000161234 ; Tnik-002; intron 2
ENSMUST00000162037 ; Tnik-016; intron 2
ENSMUST00000160307 ; Tnik-007; intron 2
ENSMUST00000159680 ; Tnik-010; intron 2
ENSMUST00000160518 ; Tnik-008; intron 2
ENSMUST00000162485 ; Tnik-009; intron 2
ENSMUST00000159308 ; Tnik-011; intron 2
ENSMUST00000162777 ; Tnik-013; intron 2
ENSMUST00000161964 ; Tnik-014; intron 2
Database links

Mature sequence mmu-miR-466q

Accession MIMAT0020631
Sequence

46 - 

gugcacacacacacauacgu

 - 65

Get sequence
Deep sequencing39 reads, 28 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).