Stem-loop sequence mmu-mir-5106

AccessionMI0018014 (change log)
Symbol MGI:Mir5106
DescriptionMus musculus miR-5106 stem-loop
Stem-loop
   c    ga  aa    aac   a   ac  g  a    a 
5'  acuc  gc  caac   agc aca  cc ag gccu u
    ||||  ||  ||||   ||| |||  || || |||| c
3'  ugag  cg  guug   ucg ugu  gg uc cggg u
   -    -a  --    -ac   a   cu  a  -    a 
Get sequence
Deep sequencing
114 reads, 27.9 reads per million, 43 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 44221195-44221267 [-]
sense
OTTMUST00000016063 ; Rnf38-014; intron 1
OTTMUST00000016064 ; Rnf38-015; intron 1
ENSMUST00000123844 ; Rnf38-014; intron 1
ENSMUST00000153116 ; Rnf38-015; intron 1
Database links

Mature sequence mmu-miR-5106

Accession MIMAT0020613
Sequence

49 - 

aggucuguagcucaguuggcaga

 - 71

Get sequence
Deep sequencing100 reads, 40 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).