Stem-loop sequence mmu-mir-5098

AccessionMI0018006 (change log)
Symbol MGI:Mir5098
DescriptionMus musculus miR-5098 stem-loop
Gene family MIPF0001275; mir-1954
Stem-loop
   au       a         u       a      uuuugu 
5'   uagccag guuacaugg gaagccc guuuug      u
     ||||||| ||||||||| ||||||| ||||||       
3'   gucgguc cgauguguc cuuuggg cagagu      u
   cu       c         u       a      uuuugu 
Get sequence
Deep sequencing
565 reads, 0 reads per million, 65 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 77272757-77272838 [+]
sense
OTTMUST00000050751 ; Rest-001; intron 2
OTTMUST00000050752 ; Rest-002; intron 2
ENSMUST00000080359 ; Rest-001; intron 2
ENSMUST00000113449 ; Rest-002; intron 2
Database links

Mature sequence mmu-miR-5098

Accession MIMAT0020605
Sequence

11 - 

guuacauggugaagcccaguu

 - 31

Get sequence
Deep sequencing21 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).