Stem-loop sequence hsa-mir-5096

Accession

MI0018004

Description

Homo sapiens miR-5096 stem-loop

Stem-loop

aguaga      - uu     a  uu       cu   c 
      gguggg g  ucacc ug  ggucagg  ggu u
      |||||| |  ||||| ||  |||||||  ||| c
      ccaccu c  agugg ac  ccagucc  uca a
------      a cu     -  -u       --   a 

Deep sequencing

69 reads, 25 experiments

Genome context

• Coordinates (GRCh37.p5): chr4: 79741906-79741975 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000362866 ; BMP2K-002; intron 1

  OTTHUMT00000362865 ; BMP2K-001; intron 1

  OTTHUMT00000362866 ; BMP2K-002; intron 1

  OTTHUMT00000362865 ; BMP2K-001; intron 1

  OTTHUMT00000362866 ; BMP2K-002; intron 1

  OTTHUMT00000362865 ; BMP2K-001; intron 1

  ENST00000389010 ; BMP2K-002; intron 1

  ENST00000502871 ; BMP2K-001; intron 1

  ENST00000335016 ; BMP2K-202; intron 1

  ENST00000264889 ; BMP2K-201; intron 1

  ENST00000389010 ; BMP2K-002; intron 1

  ENST00000502871 ; BMP2K-001; intron 1

  ENST00000335016 ; BMP2K-202; intron 1

  ENST00000264889 ; BMP2K-201; intron 1

  ENST00000389010 ; BMP2K-002; intron 1

  ENST00000502871 ; BMP2K-001; intron 1

  ENST00000335016 ; BMP2K-201; intron 1

Database links

• ENTREZGENE: 100616427;MIR5096

Mature sequence hsa-miR-5096

• Accession: MIMAT0020603
• Sequence: 13 - guuucaccauguuggucaggc - 33
• Deep sequencing: 39 reads, 14 experiments
• Evidence: experimental; RTPCR [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-5096
  • MIRDB:hsa-miR-5096
  • TARGETMINER:hsa-miR-5096

References

1. PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).