Stem-loop sequence hsa-mir-5096

AccessionMI0018004
Symbol HGNC:MIR5096
DescriptionHomo sapiens miR-5096 stem-loop
Stem-loop
   aguaga      - uu     a  uu       cu   c 
5'       gguggg g  ucacc ug  ggucagg  ggu u
         |||||| |  ||||| ||  |||||||  ||| c
3'       ccaccu c  agugg ac  ccagucc  uca a
   ------      a cu     -  -u       --   a 
Get sequence
Deep sequencing
1993 reads, 778 reads per million, 64 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 78820752-78820821 [+]
sense
OTTHUMT00000362669 ; MRPL1-002; intron 4
OTTHUMT00000362672 ; MRPL1-005; intron 4
OTTHUMT00000252518 ; MRPL1-001; intron 6
ENST00000502384 ; MRPL1-002; intron 4
ENST00000506674 ; MRPL1-005; intron 4
ENST00000315567 ; MRPL1-001; intron 6
Database links

Mature sequence hsa-miR-5096

Accession MIMAT0020603
Sequence

13 - 

guuucaccauguuggucaggc

 - 33

Get sequence
Deep sequencing76 reads, 16 experiments
Evidence experimental; RTPCR [1]
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).