Dead miRNA entry

miRNA accession:
MI0018004
miRNA ID:
hsa-mir-5096
Comment:
The pattern of smRNAseq reads mapping to the mir-5096 locus is not consistent with miRNA processing. The sequence is also similar to that of several coiled coil protein-coding genes. mir-5096 is therefore removed from miRBase 22.

Previous miRNA entry

Stem-loop sequence hsa-mir-5096

AccessionMI0018004 (change log)
Symbol HGNC:MIR5096
DescriptionHomo sapiens miR-5096 stem-loop
Stem-loop
   aguaga      - uu     a  uu       cu   c 
5'       gguggg g  ucacc ug  ggucagg  ggu u
         |||||| |  ||||| ||  |||||||  ||| c
3'       ccaccu c  agugg ac  ccagucc  uca a
   ------      a cu     -  -u       --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-5096

Accession MIMAT0020603
Sequence

13 - 

guuucaccauguuggucaggc

 - 33

Get sequence
Evidence experimental; RTPCR [1]
Database links
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).