Stem-loop sequence hsa-mir-1273g

AccessionMI0018003
Symbol HGNC:MIR1273G
DescriptionHomo sapiens miR-1273g stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop
   -    ug  a ga      ga    gggu     ag c      aagu  u 
5'  gagg  gg g  uugcuu  guca    gguug  g ugcagu    ug g
    ||||  || |  ||||||  ||||    |||||  | ||||||    ||  
3'  cucu  uc c  aacgag  cagu    ccgac  c acguca    ac a
   a    gu  - ag      -a    gagu     cu -      ccau  u 
Get sequence
Deep sequencing
941 reads, 946 reads per million, 75 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 52940314-52940413 [+]
antisense
OTTHUMT00000022473 ; ZCCHC11-012; intron 12
OTTHUMT00000022463 ; ZCCHC11-002; intron 12
OTTHUMT00000022466 ; ZCCHC11-005; intron 13
OTTHUMT00000022462 ; ZCCHC11-001; intron 13
OTTHUMT00000387710 ; ZCCHC11-017; intron 13
ENST00000528642 ; ZCCHC11-012; intron 12
ENST00000371541 ; ZCCHC11-002; intron 12
ENST00000257177 ; ZCCHC11-005; intron 13
ENST00000371544 ; ZCCHC11-001; intron 13
ENST00000484723 ; ZCCHC11-017; intron 13
Clustered miRNAs
< 10kb from hsa-mir-1273g
hsa-mir-5095chr1: 52934930-52935017 [+]
hsa-mir-1273gchr1: 52940314-52940413 [+]
Database links

Mature sequence hsa-miR-1273g-5p

Accession MIMAT0020602
Previous IDshsa-miR-1273g
Sequence

26 - 

ggugguugaggcugcaguaagu

 - 47

Get sequence
Evidence experimental; RTPCR [1]
Predicted targets

Mature sequence hsa-miR-1273g-3p

Accession MIMAT0022742
Sequence

57 - 

accacugcacuccagccugag

 - 77

Get sequence
Deep sequencing19 reads, 14 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).