Dead miRNA entry

miRNA accession:
MI0018003
miRNA ID:
hsa-mir-1273g
Comment:
Many of the miRNA loci annotated as mir-1273 family members have patterns of mapped reads from RNAseq experiments that are not consistent with the gene being processed as a miRNA. The reads may be derived from SRP RNA, or derived Alu repeats. hsa-mir-1273a,b,d,e,f,g are removed the database.

Previous miRNA entry

Stem-loop sequence hsa-mir-1273g

AccessionMI0018003 (change log)
Symbol HGNC:MIR1273G
DescriptionHomo sapiens miR-1273g stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop
   -    ug  a ga      ga    gggu     ag c      aagu  u 
5'  gagg  gg g  uugcuu  guca    gguug  g ugcagu    ug g
    ||||  || |  ||||||  ||||    |||||  | ||||||    ||  
3'  cucu  uc c  aacgag  cagu    ccgac  c acguca    ac a
   a    gu  - ag      -a    gagu     cu -      ccau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1273g-5p

Accession MIMAT0020602
Previous IDshsa-miR-1273g
Sequence

26 - 

ggugguugaggcugcaguaagu

 - 47

Get sequence
Evidence experimental; RTPCR [1]
Predicted targets

Mature sequence hsa-miR-1273g-3p

Accession MIMAT0022742
Sequence

57 - 

accacugcacuccagccugag

 - 77

Get sequence
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).