Stem-loop sequence hsa-mir-1273g

Accession

MI0018003

Description

Homo sapiens miR-1273g stem-loop

Gene family

MIPF0000579; mir-1273

Stem-loop

-    ug  a ga      ga    gggu     ag c      aagu  u 
 gagg  gg g  uugcuu  guca    gguug  g ugcagu    ug g
 ||||  || |  ||||||  ||||    |||||  | ||||||    ||  
 cucu  uc c  aacgag  cagu    ccgac  c acguca    ac a
a    gu  - ag      -a    gagu     cu -      ccau  u 

Deep sequencing

78 reads, 24 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 53405986-53406085 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000024740 ; SCP2-001; intron 1

  OTTHUMT00000387557 ; SCP2-009; intron 1

  OTTHUMT00000387558 ; SCP2-010; intron 1

  OTTHUMT00000387559 ; SCP2-007; intron 1

  OTTHUMT00000387560 ; SCP2-011; intron 1

  OTTHUMT00000024743 ; SCP2-004; intron 1

  OTTHUMT00000387561 ; SCP2-012; intron 1

  OTTHUMT00000024740 ; SCP2-001; intron 1

  OTTHUMT00000387557 ; SCP2-009; intron 1

  OTTHUMT00000387558 ; SCP2-010; intron 1

  OTTHUMT00000387559 ; SCP2-007; intron 1

  OTTHUMT00000387560 ; SCP2-011; intron 1

  OTTHUMT00000024743 ; SCP2-004; intron 1

  OTTHUMT00000387561 ; SCP2-012; intron 1

  OTTHUMT00000024740 ; SCP2-001; intron 1

  OTTHUMT00000387557 ; SCP2-009; intron 1

  OTTHUMT00000387558 ; SCP2-010; intron 1

  OTTHUMT00000387559 ; SCP2-007; intron 1

  OTTHUMT00000387560 ; SCP2-011; intron 1

  OTTHUMT00000024743 ; SCP2-004; intron 1

  OTTHUMT00000387561 ; SCP2-012; intron 1

  ENST00000371514 ; SCP2-001; intron 1

  ENST00000478631 ; SCP2-009; intron 1

  ENST00000528311 ; SCP2-010; intron 1

  ENST00000371509 ; SCP2-007; intron 1

  ENST00000407246 ; SCP2-011; intron 1

  ENST00000371513 ; SCP2-004; intron 1

  ENST00000528809 ; SCP2-012; intron 1

  ENST00000371514 ; SCP2-001; intron 1

  ENST00000478631 ; SCP2-009; intron 1

  ENST00000528311 ; SCP2-010; intron 1

  ENST00000371509 ; SCP2-007; intron 1

  ENST00000407246 ; SCP2-011; intron 1

  ENST00000371513 ; SCP2-004; intron 1

  ENST00000528809 ; SCP2-012; intron 1

  ENST00000371514 ; SCP2-001; intron 1

  ENST00000478631 ; SCP2-009; intron 1

  ENST00000528311 ; SCP2-010; intron 1

  ENST00000371509 ; SCP2-007; intron 1

  ENST00000407246 ; SCP2-011; intron 1

  ENST00000371513 ; SCP2-004; intron 1

  ENST00000528809 ; SCP2-012; intron 1

Clustered miRNAs

< 10kb from hsa-mir-1273g

• hsa-mir-5095: chr1: 53400602-53400689 [+]
• hsa-mir-1273g: chr1: 53405986-53406085 [+]

Database links

• ENTREZGENE: 100616145;MIR1273G

Mature sequence hsa-miR-1273g-5p

• Accession: MIMAT0020602
• Previous IDs: hsa-miR-1273g
• Sequence: 26 - ggugguugaggcugcaguaagu - 47
• Deep sequencing: 3 reads, 3 experiments
• Evidence: experimental; RTPCR [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1273g-5p
  • MIRDB:hsa-miR-1273g-5p
  • TARGETMINER:hsa-miR-1273g-5p

Mature sequence hsa-miR-1273g-3p

• Accession: MIMAT0022742
• Sequence: 57 - accacugcacuccagccugag - 77
• Deep sequencing: 51 reads, 14 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1273g-3p
  • MIRDB:hsa-miR-1273g-3p
  • TARGETMINER:hsa-miR-1273g-3p

References

1. PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).