Dead miRNA entry

miRNA accession:
MI0018001
miRNA ID:
hsa-mir-5095
Comment:
The mature miR-5095 sequence maps thousands of times to the human genome, and is likely therefore not a bona fide miRNA.

Previous miRNA entry

Stem-loop sequence hsa-mir-5095

AccessionMI0018001 (change log)
Symbol HGNC:MIR5095
DescriptionHomo sapiens miR-5095 stem-loop
Stem-loop
   -                  a       g     c ua  -   u 
5'  cugggauuacaggcguga ccaccgc cccgg c  ac uuu a
    |||||||||||||||||| ||||||| ||||| |  || |||  
3'  gacccuaauguccgcacu gguggcg gggcc g  ug aaa a
   c                  c       a     c gc  c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-5095

Accession MIMAT0020600
Sequence

7 - 

uuacaggcgugaaccaccgcg

 - 27

Get sequence
Evidence experimental; RTPCR [1]
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).