Stem-loop sequence hsa-mir-5095

Accession

MI0018001

Description

Homo sapiens miR-5095 stem-loop

Stem-loop

-                  a       g     c ua  -   u 
 cugggauuacaggcguga ccaccgc cccgg c  ac uuu a
 |||||||||||||||||| ||||||| ||||| |  || |||  
 gacccuaauguccgcacu gguggcg gggcc g  ug aaa a
c                  c       a     c gc  c   g 

Deep sequencing

72 reads, 23 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 53400602-53400689 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000024740 ; SCP2-001; intron 1

  OTTHUMT00000387557 ; SCP2-009; intron 1

  OTTHUMT00000387558 ; SCP2-010; intron 1

  OTTHUMT00000387559 ; SCP2-007; intron 1

  OTTHUMT00000387560 ; SCP2-011; intron 1

  OTTHUMT00000024743 ; SCP2-004; intron 1

  OTTHUMT00000387561 ; SCP2-012; intron 1

  OTTHUMT00000024740 ; SCP2-001; intron 1

  OTTHUMT00000387557 ; SCP2-009; intron 1

  OTTHUMT00000387558 ; SCP2-010; intron 1

  OTTHUMT00000387559 ; SCP2-007; intron 1

  OTTHUMT00000387560 ; SCP2-011; intron 1

  OTTHUMT00000024743 ; SCP2-004; intron 1

  OTTHUMT00000387561 ; SCP2-012; intron 1

  OTTHUMT00000024740 ; SCP2-001; intron 1

  OTTHUMT00000387557 ; SCP2-009; intron 1

  OTTHUMT00000387558 ; SCP2-010; intron 1

  OTTHUMT00000387559 ; SCP2-007; intron 1

  OTTHUMT00000387560 ; SCP2-011; intron 1

  OTTHUMT00000024743 ; SCP2-004; intron 1

  OTTHUMT00000387561 ; SCP2-012; intron 1

  ENST00000371514 ; SCP2-001; intron 1

  ENST00000478631 ; SCP2-009; intron 1

  ENST00000528311 ; SCP2-010; intron 1

  ENST00000371509 ; SCP2-007; intron 1

  ENST00000407246 ; SCP2-011; intron 1

  ENST00000371513 ; SCP2-004; intron 1

  ENST00000528809 ; SCP2-012; intron 1

  ENST00000371514 ; SCP2-001; intron 1

  ENST00000478631 ; SCP2-009; intron 1

  ENST00000528311 ; SCP2-010; intron 1

  ENST00000371509 ; SCP2-007; intron 1

  ENST00000407246 ; SCP2-011; intron 1

  ENST00000371513 ; SCP2-004; intron 1

  ENST00000528809 ; SCP2-012; intron 1

  ENST00000371514 ; SCP2-001; intron 1

  ENST00000478631 ; SCP2-009; intron 1

  ENST00000528311 ; SCP2-010; intron 1

  ENST00000371509 ; SCP2-007; intron 1

  ENST00000407246 ; SCP2-011; intron 1

  ENST00000371513 ; SCP2-004; intron 1

  ENST00000528809 ; SCP2-012; intron 1

Clustered miRNAs

< 10kb from hsa-mir-5095

• hsa-mir-1273f: chr1: 53394346-53394444 [+]
• hsa-mir-5095: chr1: 53400602-53400689 [+]
• hsa-mir-1273g: chr1: 53405986-53406085 [+]

Database links

• ENTREZGENE: 100616458;MIR5095

Mature sequence hsa-miR-5095

• Accession: MIMAT0020600
• Sequence: 7 - uuacaggcgugaaccaccgcg - 27
• Deep sequencing: 26 reads, 16 experiments
• Evidence: experimental; RTPCR [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-5095
  • MIRDB:hsa-miR-5095
  • TARGETMINER:hsa-miR-5095

References

1. PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).