Stem-loop sequence hsa-mir-5095

AccessionMI0018001
Symbol HGNC:MIR5095
DescriptionHomo sapiens miR-5095 stem-loop
Stem-loop
   -                  a       g     c ua  -   u 
5'  cugggauuacaggcguga ccaccgc cccgg c  ac uuu a
    |||||||||||||||||| ||||||| ||||| |  || |||  
3'  gacccuaauguccgcacu gguggcg gggcc g  ug aaa a
   c                  c       a     c gc  c   g 
Get sequence
Deep sequencing
717 reads, 824 reads per million, 61 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 52934930-52935017 [+]
antisense
OTTHUMT00000022473 ; ZCCHC11-012; intron 13
OTTHUMT00000022463 ; ZCCHC11-002; intron 13
OTTHUMT00000022466 ; ZCCHC11-005; intron 14
OTTHUMT00000022462 ; ZCCHC11-001; intron 14
OTTHUMT00000387710 ; ZCCHC11-017; intron 14
ENST00000528642 ; ZCCHC11-012; intron 13
ENST00000371541 ; ZCCHC11-002; intron 13
ENST00000257177 ; ZCCHC11-005; intron 14
ENST00000371544 ; ZCCHC11-001; intron 14
ENST00000484723 ; ZCCHC11-017; intron 14
Clustered miRNAs
< 10kb from hsa-mir-5095
hsa-mir-1273fchr1: 52928674-52928772 [+]
hsa-mir-5095chr1: 52934930-52935017 [+]
hsa-mir-1273gchr1: 52940314-52940413 [+]
Database links

Mature sequence hsa-miR-5095

Accession MIMAT0020600
Sequence

7 - 

uuacaggcgugaaccaccgcg

 - 27

Get sequence
Deep sequencing10 reads, 8 experiments
Evidence experimental; RTPCR [1]
Predicted targets

References

1
PMID:21377523 "Identification and analysis of novel microRNAs from fragile sites of human cervical cancer: computational and experimental approach" Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR Genomics. 97:333-340(2011).