Stem-loop sequence ssc-mir-1343

AccessionMI0017996 (change log)
DescriptionSus scrofa miR-1343 stem-loop
Gene family MIPF0001206; mir-1343
Literature search

4 open access papers mention ssc-mir-1343
(8 sentences)

Stem-loop
   --gc     u  u    a    c       -c     ucu 
5'     uucgg gc gggg gcgg ccccggg  gggcc   g
       ||||| || |||| |||| |||||||  |||||    
3'     gggcc cg ucuc cgcc ggggucc  cccgg   c
   gccu     u  c    a    c       uc     ucu 
Get sequence
Deep sequencing
127 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 28433182-28433260 [-]
sense
ENSSSCT00000014524 ; PDHX-201; intron 2
Database links

Mature sequence ssc-miR-1343

Accession MIMAT0020596
Sequence

48 - 

cuccuggggcccgcacucucgc

 - 69

Get sequence
Deep sequencing116 reads, 14 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).