Stem-loop sequence ssc-mir-491

AccessionMI0017993 (change log)
DescriptionSus scrofa miR-491 stem-loop
Gene family MIPF0000319; mir-491
Literature search

5 open access papers mention ssc-mir-491
(6 sentences)

Stem-loop
   --    cu      u      cc   c          a 
5'   uuag  ggguag ggggaa  cuu caugaggagu g
     ||||  |||||| ||||||  ||| |||||||||| a
3'   gguc  uccauc ucccuu  gaa guauuccuca a
   ug    ag      u      -a   c          c 
Get sequence
Deep sequencing
216 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 225810907-225810982 [-]
sense
ENSSSCT00000021144 ; ssc-mir-491.1-201; exon 1
Database links

Mature sequence ssc-miR-491

Accession MIMAT0020592
Sequence

11 - 

aguggggaacccuuccaugagg

 - 32

Get sequence
Deep sequencing210 reads, 12 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).