Stem-loop sequence ssc-mir-486-2

AccessionMI0017992 (change log)
DescriptionSus scrofa miR-486-2 stem-loop
Gene family MIPF0000220; mir-486
Literature search

12 open access papers mention ssc-mir-486-2
(26 sentences)

Stem-loop
   -        g   cu           c     ----   c u 
5'  cccugacg guc  guacugagcug cccga    ggc c c
    |||||||| |||  ||||||||||| |||||    ||| | a
3'  ggggcugc cgg  caugacucgac gggcu    ccg g c
   u        g   cc           c     cgac   u u 
Get sequence
Deep sequencing
6291 reads, 1.4e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf2610: 3466-3547 [-]
intergenic
Database links

Mature sequence ssc-miR-486

Accession MIMAT0013886
Sequence

11 - 

uccuguacugagcugccccgag

 - 32

Get sequence
Deep sequencing12582 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).