Stem-loop sequence ssc-mir-429

Accession MI0017991
Description Sus scrofa miR-429 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g   cc     gu u -          cg       cu  u 
 ccg  gaugg  g c uuaccaggca  guuagau  gg u
 |||  |||||  | | ||||||||||  |||||||  ||  
 ggc  uuacc  c g aauggucugu  uaaucug  cu c
-   cc     ug c u          ca       -u  u 
Get sequence
Genome context
Coordinates (Sscrofa9) Overlapping transcripts
6: 42894049-42894129 [-]
sense
antisense
ENSSSCT00000003702 ; F1RJF4_PIG; intron 1
ENSSSCT00000003285 ; RYR1_PIG; intron 49
ENSSSCT00000003285 ; RYR1_PIG; intron 49
Database links

Mature sequence ssc-miR-429

Accession MIMAT0020591
Sequence

50 - 

uaauacugucugguaaugccgu

 - 71

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).