Stem-loop sequence ssc-mir-429

AccessionMI0017991 (change log)
DescriptionSus scrofa miR-429 stem-loop
Gene family MIPF0000019; mir-8
Literature search

3 open access papers mention ssc-mir-429
(6 sentences)

Stem-loop
   g   cc     gu u -          cg       cu  u 
5'  ccg  gaugg  g c uuaccaggca  guuagau  gg u
    |||  |||||  | | ||||||||||  |||||||  ||  
3'  ggc  uuacc  c g aauggucugu  uaaucug  cu c
   -   cc     ug c u          ca       -u  u 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 58044174-58044254 [-]
intergenic
Database links

Mature sequence ssc-miR-429

Accession MIMAT0020591
Sequence

50 - 

uaauacugucugguaaugccgu

 - 71

Get sequence
Deep sequencing61 reads, 13 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).