Stem-loop sequence ssc-mir-18b

AccessionMI0017985 (change log)
DescriptionSus scrofa miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

10 open access papers mention ssc-mir-18b
(18 sentences)

Stem-loop
   ucu         --   u    c   u     ua  --g     
5'    cuuguguua  agg gcau uag gcagu  gu   aagc 
      |||||||||  ||| |||| ||| |||||  ||   ||| a
3'    ggacacggu  ucc cgua auc cguca  ua   uucg 
   guc         cu   c    a   c     uc  aga     
Get sequence
Deep sequencing
428 reads, 33.3 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 126200019-126200101 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-18b
ssc-mir-106achrX: 126200183-126200263 [-]
ssc-mir-18bchrX: 126200019-126200101 [-]
ssc-mir-20b-1chrX: 126199775-126199854 [-]
ssc-mir-19b-2chrX: 126199650-126199729 [-]
ssc-mir-92a-2chrX: 126199512-126199591 [-]
ssc-mir-363-1chrX: 126199347-126199426 [-]
Database links

Mature sequence ssc-miR-18b

Accession MIMAT0020585
Sequence

11 - 

uaaggugcaucuagugcaguuag

 - 33

Get sequence
Deep sequencing428 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).