Stem-loop sequence hsa-mir-5094

Accession MI0017983
Description Homo sapiens miR-5094 stem-loop
Stem-loop 
aaaa   aaaaa       au    --  a     a    cugc 
    gaa     ucaguga  gccu  ug accua caca    c
    |||     |||||||  ||||  || ||||| ||||     
    cuu     agucacu  cggg  ac uggau gugu    u
ucaa   -acaa       --    ug  a     g    auuu
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 90393869-90393953 [-]
sense
OTTHUMT00000417056 ; AP3S2-011; intron 1
OTTHUMT00000417056 ; AP3S2-011; intron 1
OTTHUMT00000417054 ; AP3S2-004; intron 2
OTTHUMT00000417054 ; AP3S2-004; intron 2
OTTHUMT00000313422 ; AP3S2-001; intron 4
OTTHUMT00000313422 ; AP3S2-001; intron 4
OTTHUMT00000417052 ; AP3S2-005; intron 4
OTTHUMT00000417053 ; AP3S2-006; intron 4
OTTHUMT00000417061 ; RP11-233C13.1-005; intron 4
OTTHUMT00000417307 ; RP11-233C13.1-007; intron 4
OTTHUMT00000313422 ; AP3S2-001; intron 4
OTTHUMT00000417052 ; AP3S2-005; intron 4
OTTHUMT00000417053 ; AP3S2-006; intron 4
OTTHUMT00000417061 ; RP11-233C13.1-005; intron 4
OTTHUMT00000417307 ; RP11-233C13.1-007; intron 4
OTTHUMT00000417306 ; AP3S2-013; intron 5
OTTHUMT00000417051 ; AP3S2-009; intron 5
OTTHUMT00000417308 ; RP11-233C13.1-006; intron 5
OTTHUMT00000417306 ; AP3S2-013; intron 5
OTTHUMT00000417051 ; AP3S2-009; intron 5
OTTHUMT00000417308 ; RP11-233C13.1-006; intron 5
OTTHUMT00000417055 ; AP3S2-008; intron 6
OTTHUMT00000417055 ; AP3S2-008; intron 6
OTTHUMT00000367641 ; RP11-233C13.1-001; intron 8
OTTHUMT00000367641 ; RP11-233C13.1-001; intron 8
OTTHUMT00000367641 ; RP11-233C13.1-001; intron 8
ENST00000558186 ; AP3S2-011; intron 1
ENST00000558186 ; AP3S2-011; intron 1
ENST00000559162 ; AP3S2-004; intron 2
ENST00000559162 ; AP3S2-004; intron 2
ENST00000336418 ; AP3S2-001; intron 4
ENST00000336418 ; AP3S2-001; intron 4
ENST00000557999 ; AP3S2-005; intron 4
ENST00000558806 ; AP3S2-006; intron 4
ENST00000560940 ; C15orf38-AP3S2-005; intron 4
ENST00000558648 ; C15orf38-AP3S2-007; intron 4
ENST00000336418 ; AP3S2-001; intron 4
ENST00000557999 ; AP3S2-005; intron 4
ENST00000558806 ; AP3S2-006; intron 4
ENST00000560940 ; C15orf38-AP3S2-005; intron 4
ENST00000558648 ; C15orf38-AP3S2-007; intron 4
ENST00000423566 ; AP3S2-201; intron 5
ENST00000423566 ; AP3S2-013; intron 5
ENST00000558011 ; AP3S2-009; intron 5
ENST00000559629 ; C15orf38-AP3S2-006; intron 5
ENST00000423566 ; AP3S2-013; intron 5
ENST00000558011 ; AP3S2-009; intron 5
ENST00000559629 ; C15orf38-AP3S2-006; intron 5
ENST00000558999 ; AP3S2-008; intron 6
ENST00000558999 ; AP3S2-008; intron 6
ENST00000398333 ; C15orf38-AP3S2-001; intron 8
ENST00000398333 ; C15orf38-AP3S2-001; intron 8
ENST00000398333 ; C15orf38-AP3S2-001; intron 8

Mature sequence hsa-miR-5094

Accession MIMAT0021086
Sequence

11 -  

aaucagugaaugccuugaaccu

 - 32

Get sequence
Evidence experimental; qPCR [1], Solexa [1]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).