Stem-loop sequence hsa-mir-5090

Accession MI0017979
Description Homo sapiens miR-5090 stem-loop
Stem-loop
-     --   ----accc        uu   g     u  aaag 
 ucuga  ggu        ggggcaga  ggu uaggg gc    c
 |||||  |||        ||||||||  ||| ||||| ||    c
 ggacu  ccg        ccccgucu  ccg auccc cg    u
a     gu   accucaac        -u   a     c  cccg 
Get sequence
Deep sequencing
9 reads, 4 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 102106189-102106273 [+]
sense
OTTHUMT00000349493 ; LRWD1-001; intron 1
OTTHUMT00000349496 ; LRWD1-004; intron 1
OTTHUMT00000349494 ; LRWD1-002; intron 1
OTTHUMT00000349499 ; LRWD1-007; intron 1
OTTHUMT00000349495 ; LRWD1-003; intron 2
OTTHUMT00000349497 ; LRWD1-005; exon 2
OTTHUMT00000349493 ; LRWD1-001; 3'UTR (exon 2)
OTTHUMT00000349496 ; LRWD1-004; exon 2
OTTHUMT00000349494 ; LRWD1-002; exon 2
OTTHUMT00000349497 ; LRWD1-005; exon 2
OTTHUMT00000349499 ; LRWD1-007; 3'UTR (exon 2)
OTTHUMT00000349493 ; LRWD1-001; 3'UTR (exon 2)
OTTHUMT00000349496 ; LRWD1-004; exon 2
OTTHUMT00000349494 ; LRWD1-002; exon 2
OTTHUMT00000349497 ; LRWD1-005; exon 2
OTTHUMT00000349499 ; LRWD1-007; 3'UTR (exon 2)
OTTHUMT00000349495 ; LRWD1-003; exon 3
OTTHUMT00000349495 ; LRWD1-003; exon 3
ENST00000292616 ; LRWD1-001; intron 1
ENST00000463739 ; LRWD1-004; intron 1
ENST00000473880 ; LRWD1-002; intron 1
ENST00000485808 ; LRWD1-007; intron 1
ENST00000464107 ; LRWD1-003; intron 2
ENST00000476270 ; LRWD1-005; exon 2
ENST00000292616 ; LRWD1-001; 3'UTR (exon 2)
ENST00000463739 ; LRWD1-004; exon 2
ENST00000473880 ; LRWD1-002; exon 2
ENST00000476270 ; LRWD1-005; exon 2
ENST00000485808 ; LRWD1-007; 3'UTR (exon 2)
ENST00000292616 ; LRWD1-001; 3'UTR (exon 2)
ENST00000463739 ; LRWD1-004; exon 2
ENST00000473880 ; LRWD1-002; exon 2
ENST00000476270 ; LRWD1-005; exon 2
ENST00000485808 ; LRWD1-007; 3'UTR (exon 2)
ENST00000464107 ; LRWD1-003; exon 3
ENST00000464107 ; LRWD1-003; exon 3
Clustered miRNAs
< 10kb from hsa-mir-5090
hsa-mir-5090 chr7: 102106189-102106273 [+]
hsa-mir-4467 chr7: 102111916-102111978 [+]

Mature sequence hsa-miR-5090

Accession MIMAT0021082
Sequence

11 - 

ccggggcagauugguguagggug

 - 33

Get sequence
Deep sequencing 9 reads, 4 experiments
Evidence experimental; qPCR [1], Solexa [1]
Predicted targets

References

1
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).