Stem-loop sequence osa-MIR5082

AccessionMI0017973 (change log)
DescriptionOryza sativa miR5082 stem-loop
Literature search

3 open access papers mention osa-MIR5082
(6 sentences)

Stem-loop
   ggcgggcgggugagcgcggcggccaugguugcggcggugguggcgcgcggcggcggcggcggcuagggcucaggcggcuuggugcgggagagaggcggcggcgaaggggagagaucgcuucgagagagugauuuuauagcgaggggauuaggguuuagcucuagugggccaugggggauaguuaguggaccacuaugggccgggcuagaauuaguugggccuucgcgagcccaacuugugggcuaguuuuucgcuuguaaaaggccauggggggaggaggcggcgagcuaggguuucgacccucacgaacacuacuugaucuuauccga   ug   u        -       cg      g        -----      -uu         --a   a  u  uc 
5'                                                                                                                                                                                                                                                                                                                                          gcu  ccg ccggcggc gccgcgg  gccgga ucgccucu     ccgaca   cgcgccgcc   ccg cg cc  g
                                                                                                                                                                                                                                                                                                                                            |||  ||| |||||||| |||||||  |||||| ||||||||     ||||||   |||||||||   ||| || ||   
3'                                                                                                                                                                                                                                                                                                                                          cga  ggc ggccgcug cggugcc  uggcuu ggcggaga     gguugu   gcgcggugg   ggc gu gg  u
   ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------caacaaacccacuugggcgcgccgguaguagcgugcgcgaggcuggcgcccgucagcaguag   gu   -        a       cu      g        aaggg      uuc         aag   g  u  ca 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 1286146-1286686 [+]
intergenic
Database links

Mature sequence osa-miR5082

Accession MIMAT0020582
Sequence

508 - 

ugcgaugauggccgcgcggguuca

 - 531

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence not experimental
Database links

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).