Stem-loop sequence osa-MIR5081

AccessionMI0017972 (change log)
DescriptionOryza sativa miR5081 stem-loop
Literature search

1 open access papers mention osa-MIR5081
(1 sentences)

Stem-loop
   a      -c                    c      g        c      c                a  a      c       c                   a     ug  ---aau   a 
5'  uaguga  aaacuaucaguuuguugcaa auuagu aucuauuu aguuug ugcaauaauagcgugg aa uuauca aaaacug aacuuuuacgugauaugcu cuaca  ac      ugu g
    ||||||  |||||||||||||||||||| |||||| |||||||| |||||| |||||||||||||||| || |||||| ||||||| ||||||||||||||||||| |||||  ||      |||  
3'  aucacu  uuugauaguuaaacgauguu uaauca uagauaaa ucaaac acguuguuaucguacc uu aauagu uuuugac uugaaaaugcacuauacga gaugu  ug      acg c
   -      au                    -      a        a      a                c  c      a       a                   c     ca  cacuau   a 
Get sequence
Deep sequencing
313 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 16888-17137 [-]
intergenic
Database links

Mature sequence osa-miR5081

Accession MIMAT0020581
Sequence

219 - 

uaauuuguagcaaauugauagu

 - 240

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).