Stem-loop sequence osa-MIR5079a

AccessionMI0017969 (change log)
DescriptionOryza sativa miR5079a stem-loop
Gene family MIPF0001742; MIR5079
Literature search

1 open access papers mention osa-MIR5079a
(3 sentences)

Stem-loop
   --u     auaa   g       u     gg     auc  u       agguuuacauaguuaugguucauuuacauuacccaucuaaaugauuacauaacauaaaaccuuaaugaaauggaaaaaacuuccauuuuuguguuugauuugagaaccccuugaacgccuucucaaaggguucucaaaaauucgagauagaucuaa 
5'    uucuu    uuu gaucugu auuuu  uauca   ua uaggaau                                                                                                                                                            u
      |||||    ||| ||||||| |||||  |||||   || |||||||                                                                                                                                                            u
3'    gagaa    aaa uuagaca uagaa  auggu   au auccuua                                                                                                                                                            a
   cuu     --ag   a       -     aa     --c  u       gccauaaauaggucuaaaacaagagagcgauaggcaacugucccaucuccgagacaauagguuaauaauaggauuuauccuaaaaaaaagaagaugaucaggcgagauauaagguaucaccuuuaugauuuuuuaagucuuuuuucauuuucucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 28181408-28181813 [+]
intergenic
Database links

Mature sequence osa-miR5079a

Accession MIMAT0020578
Sequence

11 - 

uuuggaucuguuauuuugguau

 - 32

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).