Stem-loop sequence osa-MIR5076

AccessionMI0017955 (change log)
DescriptionOryza sativa miR5076 stem-loop
Literature search

1 open access papers mention osa-MIR5076
(4 sentences)

Stem-loop
   c    -gauccc     u  a       au    -      -uuca  uac   u ua       ---u           a  --ua   g   -        c  uu cca      uu 
5'  aucu       agccu cu uugcuuu  uuuc agucaa     uc   uug g  agaagag    agaguuugagu uc    gca ggu ugaguaua au  g   aauaau  u
    ||||       ||||| || |||||||  |||| ||||||     ||   ||| |  |||||||    ||||||||||| ||    ||| ||| |||||||| ||  |   ||||||   
3'  uaga       uugga ga gacgagg  aaag ucaguu     ag   gac c  ucuuuuc    uuuuaagcuua ag    cgu uca auuuauau ua  c   uuauug  g
   -    aaaaagu     c  -       gu    c      cucuc  uac   - uc       cagu           -  uaac   a   u        c  uu aag      uc 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 43208622-43208850 [-]
intergenic
Database links

Mature sequence osa-miR5076

Accession MIMAT0020564
Sequence

198 - 

gaaaugggagcagagcagguuu

 - 219

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence not experimental
Database links

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).