Stem-loop sequence osa-MIR5074

AccessionMI0017950 (change log)
DescriptionOryza sativa miR5074 stem-loop
Literature search

4 open access papers mention osa-MIR5074
(5 sentences)

Stem-loop
   cgucauu  -     --  cac  u   -     ccaa    u  c  uccc  uc  cc      c  -  gc 
5'        cg ggaag  gc   cg cgg gaucg    gucg cg cg    cg  cg  gcuucg cg uc  c
          || |||||  ||   || ||| |||||    |||| || ||    ||  ||  |||||| || ||   
3'        gc ccuuc  cg   gc gcc cuagc    cagc gc gc    gc  gc  cgaggc gc ag  g
   -gccgcu  u     uu  -cc  c   u     ---c    u  c  ---c  -u  ca      c  u  aa 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 12674516-12674651 [+]
intergenic
Database links

Mature sequence osa-miR5074

Accession MIMAT0020559
Sequence

11 - 

gaaggccaccgucgggaucgc

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Database links

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).