|
miRBase |
|
Stem-loop sequence bdi-MIR5057 |
|||||
| Accession | MI0017947 | ||||
| Description | Brachypodium distachyon miR5057 stem-loop | ||||
| Stem-loop |
uggc ---cca c --- ca u acag aaauuu aaaucau uuuga aag u |||| |||||| ||||||| ||||| ||| uguc uuuaaa uuuggua aaacu uuc a ---a aaaaag - cuu cg a |
||||
| Comments |
This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1]. |
||||
| Genome context |
|
||||
Mature sequence bdi-miR5057 |
|
| Accession | MIMAT0020556 |
| Sequence |
12 - aaauuucaaaucauuuugaca - 32 |
| Evidence | not experimental |
References |
|
| 1 |
PMID:21352554
"Discovery of barley miRNAs through deep sequencing of short reads"
BMC Genomics. 12:129(2011).
|